Skip to main content

AI assistant

Sign in to chat with this filing

The assistant answers questions, extracts KPIs, and summarises risk factors directly from the filing text.

GENETIC TECHNOLOGIES LIMITED Investor Presentation 2003

Apr 30, 2003

65022_rns_2003-04-30_a666ed35-8fc2-4949-8b5e-577ddd65db14.pdf

Investor Presentation

Open in viewer

Opens in your device viewer

genetic technologies LIMITED

a commercially successful Australian biotechnology leader

Presentation May 2003

who is GTG?

  • Owner of unique, patent protected intellectual property covering noncoding DNA
  • Operator of a fee-for service DNA testing laboratory in Australia
  • Developer of other biotechnology $\bullet$ ventures including RareCellect, ImmunAid and PGGP

the people

Fred Bart, Deputy Chairman 25 years in the textiles industry Prof. Deon Venter, Head of Cancer Susceptibility Testing A specialist in the genetics of cancer Murdoch Children's Research Institute and University of Melbourne Ian Dennis, Executive Director Chartered Accountant, formerly with KPMG Dr Malcolm Simons Geneticist, expert on the HLA complex, and developer of GTG's non-coding DNA IP

Dr Mervyn Jacobson, Executive Chairman

An MBBS by profession and also founder of:

  • Regional Health Care (Australia)
  • Datalab (Australia)
  • Cytomation (U.S.) $\bullet$
  • $XY$ lnc (U.S.) $\bullet$

major shareholders are Mervyn Jacobson (39%) and Fred Bart (10%)

what is non-coding DNA?

ACATGCCCTCCAGAGTTTTATAGGGCATATAATCTGTAACAGATGAGAGGAAGCCAATTG CCCTTTAGAAATATGGCTGTGATTGCCTCACTTCCTGTGTCATGTGACGCTCCTAGTCAT CACATGACCCATCCACATCGGGAAGCCGGAATTACTTGCAGGGCTA ACCTAGTGCCTATA GCTAAGGCAGGTACCTGCATCCTTGTTTTTGTTTAGTGGATCCTCTATCCTTCAGAGACT CTGGAACCCCTGTGGTCTTCTCTTCATCTAATGACCCTGAGGGGATGGAGTTTTCAAGTC CTTCCAGAGAGGTAAGAGAGAGA GCTCCCAATCAGCATTGTCACAGTGCTTCTGGAATCC TGGCACTGGAATTTAATGAATGACAGACTCTCTTTGAATCCAGGGCCATCATGGCTCTTT GAGCAAGGCACAGATGGAGGGAGGGGTCGAAGTTGAAATGGGTGGG GCATCCTGATTTGGGGTGGGCAGAGAGTTGTCATCAGAAGGGTTGCAGGGAGAGCTGCAC CCAGGTTTCTGTGGGCCTTGTCCTAATGAATGTGGGAGACCGGGCCATGGGCACCCAAAG GCAGCTAAGCCCTGCCCAGGAGAGTAGTTGAGGGGTGGAGAGGGGCTTGCTT TTCCTCATTCTGTCCTCAGGAATGTCCCAAGCCTTTGAGTAGGGTAAGCATCATGGCTGG CAGCCTCACAGGATTGCTTCTACTTCAGGCAGTGTCGTGGGCATCAGGTGAGTGA GGCAGTGGGGAGGTAGCACAGAG CCTCCCTTCTGCCTCATAGTCCTTTGGTAGCCTTCCA GTAAGCTGGTGGTAGACTTTTAGTAGGTGCTCAATAAATCCTTTTGAGTGACTGAGACCA ACTTTGGGGTGAGGATTTTGTTTTTTTCTTTTGAAACAGAGTCTTACTCTGTTGCCTGG GCTGGAGTGCAGTGGTGCAATTTTGGCTCATTCCAACCTCTGCCTCCCAGATTCAAGCGA TTCTCTTGCTTCAGCTTCCCAGGTAGCTGGGATTACAGGCGGCCACCACTACGCCCAGCT AATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGCTGGCAAG GCAGGTCTCAAACT CCTCACCTCAGGTGATCCGCCCACCTCGGCCTCCTAAAGTGCTAGGATTACAGGTGTGAG CCCCTGCGCCCGGCCAAGGGGTGAGGAATTTTGAAACCGTGTTCAGTCTCCTAGCAGA TGTGTCCATTCTCCATGTCTTCA TCAGACCTCACTCTGCTTGTACTCCCTCCCTCCCAGG TGCCCGCCCCTGCATCCCTAAAAGCTTCGGCTACAGCTCGGTGGTGTGTGT CACATACTGTGACTCCTTTGACCCCCCGACCTTTCCTGCCCTTGGTACCTTCAGCCGCTA TGAGAGTACACGCAGTGGGCGACGGATGGAGCTGAGTATGGGGCCCATCCAGGCTAATCA CACGGGCACAGGTAACCATTACACCCCTCACCCCCTGGGCCAGGCTGGGTCCTCCTAGAG GTAAATGGTGTCAGTGATCACCATGGAGTTTCCCGCTGGGTACTGA TACCCTTATTCCCT GTGGATGTCCTCAGGCCTGCTACTGACCCTGCAGCCAGAACAGAAGTTCCAGAAAGTGAA

GTAAGAGAGAGA N non-coding DNA

CTTCCAGAGAG coding DNA

GTG proved to the world that non-coding DNA isn't junk

... it is essential in:

  • typing organs for transplant purposes;
  • settling disputed paternity;
  • forensics; and
  • testing for genetically susceptibility
  • to diseases such as breast cancer.

...not to mention

Non-coding DNA is essential to understanding coding DNA, as indicated by the now sequenced mouse genome.

GTG's IP position in non-coding DNA is solid via ownership of two broad groups of patents:

  • Intron Sequence Analysis Method for Detection of Adjacent and Remote Locus Alleles as Haplotypes (U.S. patents 5,192,659, 5,612,179 and 5,789,568) ... covers use of non-coding DNA when examining DNA to perform genetic analysis
  • Genomic Mapping Method by Direct Haplotyping Using Intron Sequence Analysis (U.S. patent $5,851,762$

... covers use of non-coding DNA when mapping the location of genes of interest

potential licensees are numerous

  • genomics companies
  • genetic testing firms
  • developers of gene $\bullet$ diagnostic devices

  • owners of proprietary genes $\bullet$

  • pharmaceutical companies
  • bioinformatics companies $\bullet$ .
  • genetic researchers

number of potential licensees:

1 May 03 - 1783 (AGM Nov 02 - 879) number of infringing licensees: 1 May 03 - 465 (AGM Nov 02 - 290) number of licensees secured to date: 1 May 03 - 7 $(AGM Nov 02 - 5)$

GTG is implementing a successful commercialisation strategy for non-coding DNA

  • patent insurance
  • U.S.-based legal team
  • database of potential licensees
  • regular contact with potential licensees

FAEGRE & BENSON LLP

· license fee rising with each deal

A Limited Liability Partnership Including Law Corporations

the cost of a license increased throughout 2002 and into 2003

total deal value to date: A\$9.9m

the October 2002 deal with Myriad Genetics was a landmark for GTG

  • Myriad owns patents over the BRCA1 and BRCA2. When mutated, these genes raise susceptibility to breast cancer from 10% to between 35% and 80%
  • Myriad paid GTG a US\$1m upfront license fee to use GTG's non-coding DNA IP
  • Myriad will pay GTG an ongoing annual license fee

  • GTG was granted the right to $\bullet$ conduct various Myriad cancer susceptibility tests in Australia, New Zealand and Southeast Asia
  • breast cancer testing based on BRCA1 and BRCA2 genes will start in Melbourne from 2003.

the March 2003 deal with Pyrosequencing AB leveraged various aspects of GTG's business to create shareholder value

  • 1) A\$0.8m license fee, plus
  • 2) A\$2.2m in royalties on reagent sales to 2015 expands the life of GTG's revenue from the deal, plus
  • 3) three analytical instruments worth A\$0.7m supplied for use in our genetic testing business, plus
  • 4) seven gene-based assays $\bullet$ worth A\$1.3m expands the tests the GTG lab can offer

an April 2003 deal with ARUP opened up a programme license genetic testing laboratories

  • Associated Regional and University Pathologists, owned by the University of Utah, paid US\$75,000 for a non-coding DNA license
  • there are between 100 and 200 major genetic testing labs similar to ARUP in the U.S. alone
  • Negotiations with other laboratories are proceeding

patent life is favourable to GTG

  • intron sequence analysis: U.S. until 2010, Europe until 2013
  • · genomic mapping: U.S. until 2015, Europe until 2016
  • all licensees to date have required both patents.

GTG is a leader in fee for service DNA testing

  • 2002 revenue was \$1.6m, but grew 20% on 2001
  • GTG is the largest disputed paternity DNA lab in Australia
  • The Myriad cancer susceptibility tests indicate strong $\bullet$ growth for the business looking forward
  • The lab is moving on a number of growth options, $\bullet$ including forensics testing, Amnio-PCR™ and AgGenomics (GTG 50.1%)

revenue from the testing business has been growing

RareCellect® will seek to improve genetic testing of the unborn

based on granted patents (see U.S.patents 5,153,117 and 5,447,842)

  • safer than amniocentesis and chorionic villus biopsy
  • potentially deepens the market by being less expensive than these procedures
  • now being commercialised

GTG has invested in various other promising ventures

  • PGGP doing genomics work on parasites such as cryptosporidium at the University of Melbourne
  • ImmunAid (GTG 60%) developing a potential AIDS treatment at the University of Western Australia that was initially devised by a GTG consulting scientist, Martin Ashdown

GTG's financial position is solid

  • $\cdot$ debt: $$0m$
  • Low burn rate: net operating cash outflow for the year to $\bullet$ Mar 2003 of \$1.04m
  • First positive quarter in December 2002: net operating cash inflow of \$0.5m
  • cash (as at 31/3/2003): $$7.3m$

creating shareholder value

  • projections based on our licensing success to date indicates strong value emerging for GTG shareholders
  • strong upside from master possible license arrangement can enhance this value creation process

the stock

  • Listed shares: 261.5m
  • Unlisted options (exercise price 20 cents to 61 cents, expiry 4/2005 and 11/2007): 80.7m
  • Total diluted shares: 80.7
  • Top 20 shareholders: approx: 68%
  • Listed on ASX since August 2000 (ASX Code GTG) $\bullet$ as well as OTC on Nasdaq (GNTLF) since 2002. All time high 93 cents.
  • Member of the All Ordinaries Index (0.01% weight)
  • Market cap (as at 30/04/03): \$89m $\bullet$
  • Monthly turnover of stock approx \$1.1m (prior to April $\bullet$ 03)

GTG has been making a social investment

...by sponsorship of efforts to save from extinction the brushtailed rock wallaby

www.gtg.com.au

Disclaimer: This document has been prepared by the management of Genetic Technologies Limited for the benefit of brokers, analysts and institutional investors and not as specific advice to any particular party or person. The information is based on publicly available information, internally developed data and other sources. No independent verification of those sources has been undertake and where any opinion is expressed in this document it is based on the assumptions and limitations mentioned herein and is an expression of present opinion only. This document is for information only and should not be construed as a prospectus or a formal support to any capital raising activities.