Regulatory Filings • Sep 17, 2020
Regulatory Filings
Open in ViewerOpens in native device viewer
WASHINGTON, D.C. 20549
For the month of September 2020
Commission File Number: 001-36187
(Translation of Registrant's Name into English)
13 Gad Feinstein Street Park Rehovot P.O.B 2100 Rehovot 7612002 Israel
(Address of principal executive offices)
Indicate by check mark whether the registrant files or will file annual reports under cover of Form 20-F or Form 40-F.
Form 20-F ☒Form 40-F ☐
Indicate by check mark if the registrant is submitting the Form 6-K in paper as permitted by Regulation S-T Rule 101(b)(1): ____
Indicate by check mark if the registrant is submitting the Form 6-K in paper as permitted by Regulation S-T Rule 101(b)(7): ____
Attached hereto and incorporated by reference herein is the following exhibit:
99.1A Slide Presentation: Canonic Ltd. Investor Presentation –September 2020.
Pursuant to the requirements of the Securities Exchange Act of 1934, the Registrant has duly caused this report to be signed on its behalf by the undersigned, thereunto duly authorized.
Date: September 17, 2020
EVOGENE LTD. (Registrant)
By: /s/ Dorit Kreiner
——————————————
Dorit Kreiner Chief Financial Officer EXHIBIT INDEX
| EX | DE |
|---|---|
| HIB | SC |
| IT | RIP |
| NO | TIO |
| N | |
| 99. 1 |
A S lide Pr tion : C nic Lt d. I r P atio Sep ber 20 20. nta sto ent tem ese ano nve res n – |

Exhibit 99.1

This presentation contains "forward-looking statements, and we may from time to time make other statements, regarding our outlook or expectations for future financial or operating or other matters regarding or affecting Evogene Ltd. or its subsidiaries, induding Canonic Ltd. ("Subsidian" or "Company") (collectively, "Evogene" on "we"), that are coloring statements" as defined in the U.S. Private Securites Litigation Reform Act of 1995 (the "PSIR") and other securities laws. Such forward-looking statements may be identified by the use of such ","should", "banned", "intend" , "intend" and "potential" or word is using forvard-looking statements in this presentation when it discusses its near-tem value drivers, including statements to the it will reach commercialization, its short-term milestones and commercal milestones. For these statements, Evogene and Subscion of the safe harbor for forward-looking statements contained in the PSLR and other securities laws.
Such statements are based on current expections and assumptons, describe opinions about future events, involve certain risks and uncertainties which are difficult to predict and are not guarantes Therefore, actual future results, performance or achievenents, and trends in the future of Subsidian and Evogene may differ materially from what is expressed or implied by such for a variety of factors, many of which are beyond Subsidiary s and Evogenes without imitation, those described in greater detail in Evogene's Annual Report on Form 20-F and in other information it files and fumishes with the U.S. Securities and Exchange Commission, including those factors under the heading "Risk Factors".
All wirten and oral forward-looking statements atting on our behalf are expressy qualified in their entirety by the previous statements. Except for any obligations to disclose information as requires laws Subsidiary and Evogene disclaim any obligation or commitment o update any information contained in this presentation or to publicy release the results to any statements that may be made to reflect future events or developments or changes in expectations, estimates, projections and assumptions.
The information contained herein does not constitute a prospects or other of form part of any invitation or offer to sel, or any solicitation of any invitation or offer to purchase of Evogene or Subsidiany, nor shall the information or any part of it or the fact of its distribution form the basis of, or be relied on in contract, commitment or relating thereto or to the securities of Evogene or Subsidiary.
The trademarks included heren are the property of the ent are used for reference purposes only. Such use should not be construent of the products or services of Evogene or Subsidiary.

Commercialize effective, precise and stable medical cannabis products for optimized therapeutic impact
| Founded in 2019 as a spinoff from Evogene Ltd (EVGN) |
We aim to develop & commercialize medical cannabis products |
We aim to bring products all the way to the market starting from genetics to reach patients |
||
|---|---|---|---|---|
| Our products under development are based on stable high yield plants with optimized therapeutic effects |
Al -based computational platform seeks to empower our plant breeding pipeline |
|||
| Commercialization is expected in early 2022, up to 4 products in the following 3 years |
Medical cannabis is >60% of the global market
(source: prohibition partners Nov 2019)


= 7 | All rights resered to Canonic Ltd. © Canonic Ltd. © Canadic ============================================================================================================


Quickly and cost effectively reach the end user, by leveraging proprietary genomic expertise and outsourcing downstream elements of the value chain

Quickly and cost effectively reach the end user, by leveraging proprietary genomic expertise and outsourcing downstream elements of the value chain


Stable enhancement of total plant compounds. Focus on agronomic and consumer traits.

Increased compounds per plant [e.g. Increased trichomes prevalence]

= 13 | All rights reserved to Canonic Ltd. © =
Increased compounds per area [e.g. Dwarf & early flowering]
Stable enhancement of specific active compounds. Focus on therapeutic traits.

Medical indication focus [e.g. Pain & Inflammation]

Compound profile focus [e.g. CBG, CBC]
Canonic expects to commercialize its first varieties during 2022

Canonic expects to commercialize its first varieties during 2022

Medical indication focus

We generate pre-clinical data to guide our breeding program towards specific medical indications
= 16 | All rights reserved to Canonic Ltd. © ---------------------------------------------------------------------------------------------------------------------------------
Canonic is developing and validating its varieties in collaboration with leading research centers



= 19 | All rights reserved to Canonic Ltd. ©



Re-engineering traditional Cannabis breeding- Computational Technology
| Unique database | Computational genomics | High throughput plant breeding | ||
|---|---|---|---|---|
| >>> | Proprietary Comparative Genomics ATTTCCGCACAAGGATTAGT ATCGCTTCACATAGGAAGT Novel Genes & Markers (IP protected) |
Computed phenotyping >>> Genetic markers assisted selection |
>>> | MetaYield+ Precise+ |
| 21 All rights reserved to Canonic Ltd. © | THC / CBD / CBG / Functional Cannabinoids patterns |
Pre-Clinical trials | CANONI |





Ofer Haviv Chairman of the board Evogene CEO and President
Raanan Cohen Business strategy Former CEO Koor industries

Dr. Yossi Tam Cannabinoid clinical research Director, Multidisciplinary Center for Cannabinoid Research of the Hebrew university

Dr. Yariv Brotman Plant metabolic pathways Ben Gurion University & Max Planck institute of Molecular Plant Physiology

Dorit Kreiner Finance Evogene CFO

Shai Leviatov
Plant breeding
Commercial varieties breeding for more than 30 years in top leading multinational seeds companies.

Adv. Itay Rosenferld Business strategy
Cannabis entrepreneur and former BOD member of Intelicanna (TLV:INTL)

Nirit Elyovich Marketing strategy
Senior marketing specialist with over 20 years of B2C experience in various markets

= 26 | All rights reserved to Canonic Ltd. © =
-- CANONIC -


| Canonic aims to develop and commercialize medical grade Cannabis through a revolutionary genomic approach |
Initial commercialization expected in 2022 |
|---|---|
| Exclusive access to Evogene's CPB technology platform |
Infrastructure in place - from seed to sale |
| Commercial partners in place for cultivation and production (IL & EU) |
Leading academic partnerships for unique variety development |
| All rights reserved to Canonic Ltd. | ANON |

Building tools?
Free accounts include 100 API calls/year for testing.
Have a question? We'll get back to you promptly.